Bad News Wrapped in Protein: Inside the Coronavirus Genome

New York Times – by Jonathan Corum and Carl Zimmer

A virus is “simply a piece of bad news wrapped up in protein,” the biologists Jean and Peter Medawar wrote in 1977.

In January, scientists deciphered a piece of very bad news: the genome of SARS-CoV-2, the virus that causes Covid-19. The sample came from a 41-year-old man who worked at the seafood market in Wuhan where the first cluster of cases appeared.

Researchers are now racing to make sense of this viral recipe, which could inspire drugs, vaccines and other tools to fight the ongoing pandemic.

A String of RNA

Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome.

The genome of the new coronavirus is less than 30,000 “letters” long. (The human genome is over 3 billion.) Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.

The first sequence of RNA letters reads:

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

This sequence recruits machinery inside the infected cell to read the RNA letters — acg and u — and translate them into coronavirus proteins.

Read the rest here: https://www.nytimes.com/interactive/2020/04/03/science/coronavirus-genome-bad-news-wrapped-in-protein.html?smid=em-share

 

Start the Conversation

Your email address will not be published. Required fields are marked *


*